AI & ChatGPT searches , social queriess for RECOGNITION SEQUENCE
Search references for RECOGNITION SEQUENCE. Phrases containing RECOGNITION SEQUENCE
See searches and references containing RECOGNITION SEQUENCE!
Search references for RECOGNITION SEQUENCE. Phrases containing RECOGNITION SEQUENCE
See searches and references containing RECOGNITION SEQUENCE!RECOGNITION SEQUENCE
DNA sequence (or subset thereof), to which the domain is specific
A recognition sequence is a DNA sequence to which a structural motif of a DNA-binding domain exhibits binding specificity. Recognition sequences are palindromes
Recognition_sequence
Class of enzymes which cleave nucleic acids
example, the nuclease EcoRI has the recognition sequence 5'—GAATTC—3'. When the enzyme encounters this sequence, it cleaves each backbone between the
Nuclease
Type of amino acid sequence
A nuclear localization sequence, or signal (NLS) is an amino acid sequence motif that 'tags' a protein for import into the cell nucleus by nuclear transport
Nuclear_localization_sequence
Restriction enzyme
enzyme isolated from the bacterium Nocardia otitidis. Palindromic recognition sequence of NotI: 5'-GCGGCCGC-3' 3'-CGCCGGCG-5' The ends generated by NotI
NotI
Automated recognition of patterns and regularities in data
make predictions about unknown events Prior knowledge for pattern recognition Sequence mining – Data mining techniquePages displaying short descriptions
Pattern_recognition
Class of enzymes that divide DNA
enzymes recognize a specific sequence of nucleotides and produce a double-stranded cut in the DNA. The recognition sequences can also be classified by the
Restriction_enzyme
Restriction enzyme
negative species, Providencia stuartii. PstI cleaves DNA at the recognition sequence 5′-CTGCA/G-3′ generating fragments with 3′-cohesive termini. This
PstI
Video game genre
problem-solving skills, including logic, pattern recognition, sequence solving, spatial recognition, and word completion. Many puzzle games involve a
Puzzle_video_game
Restriction enzyme
by Newman, et al. (1995). BamHI binds at the recognition sequence 5'-GGATCC-3', and cleaves these sequences just after the 5'-guanine on each strand. This
BamHI
Class of transposable elements that cause hybrid dysgenesis in eukaryotes
Naturally-occurring P elements contain coding sequence for the enzyme transposase and recognition sequences for transposase action. Transposase regulates
P_element
Self-stabilizing region of a protein that binds to specific DNA sequences
or single-stranded DNA. A DBD can recognize a specific DNA sequence (a recognition sequence) or have a general affinity to DNA. Some DNA-binding domains
DNA-binding_domain
DNA or RNA sequence that matches its complement when read backwards
A palindromic sequence is a nucleic acid sequence in a double-stranded DNA or RNA molecule whereby reading in a certain direction (e.g. 5' to 3') on one
Palindromic_sequence
Enzymes which cleave a nucleotide chain
Endonucleases differ from exonucleases, which cleave the ends of recognition sequences instead of the middle (endo) portion. Some enzymes known as "exo-endonucleases"
Endonuclease
Restriction enzyme
EcoRV forms a homodimer in solution before binding and acting on its recognition sequence. Initially the enzyme binds weakly to a non-specific site on the
EcoRV
Restriction enzyme
AATT. The nucleic acid recognition sequence where the enzyme cuts is G↓AATTC, which has a palindromic complementary sequence of CTTAA↓G. EcoRI was one
EcoRI
Restriction enzyme
molecular biology, it is commonly used as a restriction enzyme. Recognition sequence of NdeI: 5'CATATG 3'GTATAC The ends generated by NdeI digest: 5'---CA
NdeI
Type of enzyme
functional attribute to the host organism. Homing endonuclease recognition sequences are long enough to occur randomly only with a very low probability
Homing_endonuclease
enzyme. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: A
List_of_restriction_enzyme_cutting_sites:_A
Automatic conversion of spoken language into text
Speech recognition (automatic speech recognition (ASR), computer speech recognition, or speech-to-text (STT)) is a sub-field of computational linguistics
Speech_recognition
Class of chemical compounds
also differ from other RiPPs based on the presence of a C-terminal recognition sequence in addition to the N-terminal leader peptide (MSDIN). α-Amanitin
Ribosomally synthesized and post-translationally modified peptides
Ribosomally_synthesized_and_post-translationally_modified_peptides
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: T–Z
List_of_restriction_enzyme_cutting_sites:_T–Z
are endodeoxyribonucleases characterized by a large recognition site (double-stranded DNA sequences of 12 to 40 base pairs); as a result this site generally
Meganuclease
Strain of bacteria
preventing the methylation of a cytosine on both strands within the recognition sequence 5'-CC(A/T)GG-3'. This facilitates further processing of purified
Escherichia_coli_BL21(DE3)
sequence labeling is a type of pattern recognition task that involves the algorithmic assignment of a categorical label to each member of a sequence of
Sequence_labeling
specific DNA sequence, usually short (3 to 8 bp), and cut it, producing either blunt or overhung ends, either at or nearby the recognition site. Restriction
List of restriction enzyme cutting sites
List_of_restriction_enzyme_cutting_sites
Family of machine learning approaches
models, speech recognition, and text summarization. Seq2seq uses sequence transformation: it turns one sequence into another sequence. One naturally wonders
Seq2seq
Deliberate fragmentation of DNA in preparation for analysis
twelve-nucleotide sequence, recognition sequences tend to occur by chance in any long sequence. Restriction enzymes specific to hundreds of distinct sequences have
Restriction_digest
type of restriction enzyme that has a long or uncommon recognition sequence. Since these sequences don't appear often in genomes, the enzyme cleaves DNA
Rare-cutter_enzyme
DNA-editing technology
downstream from the PAM site. This characteristic ensures that the recognition sequence remains intact after repair, enabling Cas12a to perform multiple
Cas12a
Dense cluser of restriction sites in DNA
facilitating blue-white screening for recombinant selection. By including recognition sequences for a variety of restriction enzymes, the MCS greatly enhances flexibility
Multiple_cloning_site
Computerized information extraction from images
applications, including computer vision, speech recognition, identification of albuminous sequences in bioinformatics, production control, time series
Computer_vision
Study of DNA modifications that do not change its sequence
study of changes in gene expression that occur without altering the DNA sequence. The Greek prefix epi- (ἐπι- "over, outside of, around") in epigenetics
Epigenetics
Molecular cloning method for DNA assembly
DNA outside of their recognition sites and, therefore, can create non-palindromic overhangs. Since 256 potential overhang sequences are possible, multiple
Golden_Gate_Cloning
DNA region at which restriction enzymes cleave
sites, or restriction recognition sites, are regions of a DNA molecule containing specific (4-8 base pairs in length) sequences of nucleotides; these
Restriction_site
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: S
List_of_restriction_enzyme_cutting_sites:_S
Mobile genetic element in the primate genome (including human genome)
TATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC. The recognition sequence of the Alu I endonuclease is 5' ag/ct 3'; that is, the enzyme cuts
Alu_element
Protein that regulates the rate of DNA transcription
In molecular biology, a transcription factor (TF) (or sequence-specific DNA-binding factor) is a protein that controls the rate of transcription of genetic
Transcription_factor
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: E–F
List_of_restriction_enzyme_cutting_sites:_E–F
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: G–K
List_of_restriction_enzyme_cutting_sites:_G–K
Pair of restriction enzymes
recognition sequence. The term is derived from Greek iso 'same' and skihzo 'to split'. The first enzyme discovered which recognizes a given sequence is
Isoschizomer
Algorithm for measuring similarity between temporal sequences
audio signals. Sequence averaging: a GPL Java implementation of DBA. The Gesture Recognition Toolkit|GRT C++ real-time gesture-recognition toolkit implements
Dynamic_time_warping
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: C–D
List_of_restriction_enzyme_cutting_sites:_C–D
Finds likely sequence of hidden states
bioinformatics. For instance, in speech-to-text (speech recognition), the acoustic signal is the observed sequence, and a string of text is the "hidden cause" of
Viterbi_algorithm
Restriction enzyme
isolated from the bacterium Thermus aquaticus in 1978. It has a recognition sequence of 5'TCGA 3'AGCT and makes the cut 5'---T CGA---3' 3'---AGC T---5'
TaqI
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: L–N
List_of_restriction_enzyme_cutting_sites:_L–N
Topics referred to by the same term
amoebic meningoencephalitis Protospacer adjacent motif, a genetic DNA recognition sequence PAM graphics format, used by Netpbm PAM library, Parallel Augmented
PAM
Nucleic acid motif in molecular biology
The Kozak consensus sequence (Kozak consensus or Kozak sequence) is a nucleic acid motif that functions as the protein translation initiation site in
Kozak_consensus_sequence
Defense system in bacteria and archaea
and methylation. Cleavage occurs at variable distances from the recognition sequence, so discrete bands are not easily visualized by gel electrophoresis
Restriction modification system
Restriction_modification_system
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: Bsa–Bso
List_of_restriction_enzyme_cutting_sites:_Bsa–Bso
Most common variant of a genetic sequence across samples
molecular biology and bioinformatics, the consensus sequence (or canonical sequence) is the calculated sequence of most frequent residues, either nucleotide
Consensus_sequence
Statistical Markov model
prediction Handwriting recognition Alignment of bio-sequences Time series analysis Activity recognition Protein folding Sequence classification Metamorphic
Hidden_Markov_model
to sequence) and those that cleave only at very specific sequences (so-called restriction endonucleases). When recognition of a specific sequence is required
Glossary of cellular and molecular biology (0–L)
Glossary_of_cellular_and_molecular_biology_(0–L)
Emotion modeling in AI
case of affect recognition, the outputs represent the sequence of speech feature vectors, which allow the deduction of states' sequences through which
Affective_computing
Nucleotide or amino-acid sequence pattern
In biology, a sequence motif is a nucleotide or amino-acid sequence pattern that is widespread and usually assumed to be related to biological function
Sequence_motif
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: Bst–Bv
List_of_restriction_enzyme_cutting_sites:_Bst–Bv
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: Ba–Bc
List_of_restriction_enzyme_cutting_sites:_Ba–Bc
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: O–R
List_of_restriction_enzyme_cutting_sites:_O–R
Process of modifying a gene
structural drawback to unmodified SPAs as gene modulators is that their recognition sequence cannot be extended beyond 5 Watson-Crick base pairings. The natural
Therapeutic_gene_modulation
Naturally occurring P elements contain: coding sequence for the enzyme transposase; recognition sequences for transposase action. Transposase is an enzyme
Transposons_as_a_genetic_tool
Computer language processing metric
Word error rate (WER) is a common metric of the performance of a speech recognition or machine translation system. The WER metric typically ranges from 0
Word_error_rate
Determining the position and orientation of a robot by analyzing associated camera images
Pattern Recognition: 21–23. Retrieved 7 June 2010. Burger, W.; Bhanu, B. (Nov 1990). "Estimating 3D egomotion from perspective image sequence". IEEE Transactions
Visual_odometry
Pair of restriction enzymes
slightly different recognition sequences, but upon cleavage of DNA, generate identical overhanging termini sequences. These sequences can be ligated to
Isocaudomer
Transcription is heterocatalytic function of DNA
Different classes of sequence elements are found in the promoters. For example, the TATA box is the highly conserved DNA recognition sequence for the TATA box
Eukaryotic_transcription
Process of locating specific genes
Restriction enzymes are enzymes that help cut segments of DNA at specific recognition sequences. The basis to restriction mapping involves digesting (or cutting)
Gene_mapping
RNA family
intron recognition through a 7-12 nucleotide sequence between 18-40 nucleotides upstream of the 3´ splice site known as the branch point sequence (BPS)
U2_spliceosomal_RNA
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: Bsp–Bss
List_of_restriction_enzyme_cutting_sites:_Bsp–Bss
Type of neural network output and associated scoring function
networks to tackle sequence problems where the timing is variable. It can be used for tasks like on-line handwriting recognition or recognizing phonemes
Connectionist temporal classification
Connectionist_temporal_classification
Uptake signal sequences (USS) are the short DNA sequences preferentially taken up by competent bacteria of the family Pasteurellaceae (e.g., Haemophilus
Uptake_signal_sequence
DNA sequence required in bacterial promoters for transcription
The Pribnow box (also known as the Pribnow-Schaller box) is a sequence of TATAAT of six nucleotides (thymine, adenine, thymine, etc.) that is an essential
Pribnow_box
Class of statistical modeling methods
natural language processing or biological sequences, part-of-speech tagging, shallow parsing, named entity recognition, gene finding, peptide critical functional
Conditional_random_field
Method of biometric identification
Iris recognition is an automated method of biometric identification that uses mathematical pattern-recognition techniques on video images of one or both
Iris_recognition
Sequence in a genome
origin of replication (also called the replication origin) is a particular sequence in a genome at which replication is initiated. Propagation of the genetic
Origin_of_replication
American actress
gained recognition performing on Broadway before transitioning to film roles. She attracted early film attention for her appearance in the dance sequence “Air
Sandahl_Bergman
Macromolecule involving monomeric sequence-control
A sequence-controlled polymer is a macromolecule, in which the sequence of monomers is controlled to some degree. This control can be absolute but not
Sequence-controlled_polymer
Class of enzymes
bipartite DNA recognition sequence. In the presence of the R subunit, the complex can also act as an endonuclease, binding to the same target sequence but cutting
DNA_methyltransferase
action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically
List of restriction enzyme cutting sites: Bd–Bp
List_of_restriction_enzyme_cutting_sites:_Bd–Bp
The methylation of nucleobases in a DNA molecule inhibits recognition of the methylated sequence by DNA-binding proteins, which can effectively silence the
Glossary of cellular and molecular biology (M–Z)
Glossary_of_cellular_and_molecular_biology_(M–Z)
Protein-RNA complex
The signal recognition particle (SRP) is an abundant, cytosolic, universally conserved ribonucleoprotein (protein-RNA complex) that recognizes and targets
Signal_recognition_particle
Genetic marker commonly used in human genetics investigations
HaeIII, comprising the SNP in their recognition sequence GGCC. HaeIII cuts the taster allele (having the sequence GGCC); this generates a length polymorphism
PTC_tasting
Method of human learning
types of sequence learning. There are four basic sequence learning problems: sequence prediction, sequence generation, sequence recognition, and sequential
Sequence_learning
Computer recognition of music notation
provided with a perfect scan of typeset music, the visual recognition can be solved with a sequence of fairly simple algorithms, such as projections and template
Optical_music_recognition
Family of DNA sequences found in prokaryotic organisms
repeats) is a family of DNA sequences found in the genomes of prokaryotic organisms such as bacteria and archaea. Each sequence within an individual prokaryotic
CRISPR
Enzyme
aegyptius bacteria. The enzyme's recognition site—the place where it cuts DNA molecules—is the GGCC nucleotide sequence which means it cleaves DNA at the
HaeIII
Topical guide to object recognition
Object recognition – technology in the field of computer vision for finding and identifying objects in an image or video sequence. Humans recognize a multitude
Outline_of_object_recognition
Method of protein structure prediction
In molecular biology, protein threading, also known as fold recognition, is a method of protein modeling which is used to model those proteins which have
Threading_(protein_sequence)
Ability to automatically recognize targets
Tae Han (2013-02-01). "Automatic target recognition and tracking in forward-looking infrared image sequences with a complex background". International
Automatic_target_recognition
Restriction enzyme
'P', meaning that it has symmetric target and cleavage sites. Its recognition sequence is 5' CGGCG and 3' GCCGGC and its cut is 5' ---C GGCCG--- 3' and
AaaI
Differential transmission of genes residing in the same genome
is repaired by using the sequence of the HEG as template. HEGs encode sequence-specific endonucleases. The recognition sequence (RS) is 15–30 bp long and
Intragenomic_conflict
Molecular biology technique to type organisms
Multilocus sequence typing (MLST) is a technique in molecular biology for the typing of multiple loci, using DNA sequences of internal fragments of multiple
Multilocus_sequence_typing
Machine learning model for speech
Whisper is a machine learning model for speech recognition and transcription, created by OpenAI and first released as open-source software in September
Whisper (speech recognition system)
Whisper_(speech_recognition_system)
Family of restriction endonucleases
and Bse634I recognise the double-stranded sequence RCCGGY and cleave after the purine R. Recognition sequence Cut 5' RCCGGY 5' ---R CCGGY--- 3' 3' YGGCCR
Cfr10I/Bse634I
Type of genetic engineering
of more stringent DNA sequence recognition; however, the construction of sequence-specific enzymes for all possible sequences is costly and time-consuming
Genome_editing
Similar DNA, RNA or protein sequences within genomes or among species
conserved sequences are identical or similar sequences in nucleic acids (DNA and RNA) or proteins across species (orthologous sequences), or within
Conserved_sequence
Experimental gene therapy
bacteria-derived REases, whose non-specificity (due to their short recognition sequences) unfortunately, rendered them toxic to the host genome. The latter-potential
Zinc finger nuclease treatment of HIV
Zinc_finger_nuclease_treatment_of_HIV
RNA family
conserved helix which interacts with the SRP54 M domain mediates signal sequence recognition. The SRP19-helix 6 complex is thought to be involved in SRP assembly
Signal recognition particle RNA
Signal_recognition_particle_RNA
Enzyme
restriction enzyme will form 15-20 hydrogen bonds with the bases of the recognition sequence. With the aid of other van der Waals interactions, this bonding facilitates
HindIII
Modified genetic code
achieved by changing the recognition sequence of the mRNA, the Shine-Dalgarno sequence, and the corresponding recognition sequence in the 16S rRNA of ribosomes
Expanded_genetic_code
Study and analysis of groups of sedimentary deposits
Sequence stratigraphy is a form of stratigraphy that attempts to discern and understand historic geology through time by subdividing and linking sedimentary
Sequence_stratigraphy
Type of restriction enzymes
Withers, Barbara E.; Dunbar, Joan C. (1995). "DNA determinants in sequence-specific recognition by Xm al endonuclease". Nucleic Acids Research. 23 (17): 3571–3577
Neoschizomer
Family of transcription factors
to specific sequences of DNA with high affinity. Family members contain an unusual DNA binding domain that binds to the recognition sequence 5'-TTGGCXXXXXGCCAA-3'
Nuclear_factor_I
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
Surname or Lastname
English
English : from a medieval male personal name (from Latin Hilarius, a derivative of hilaris ‘cheerful’, ‘glad’, from Greek hilaros ‘propitious’, ‘joyful’). The Latin name was chosen by many early Christians to express their joy and hope of salvation, and was borne by several saints, including a 4th-century bishop of Poitiers noted for his vigorous resistance to the Arian heresy, and a 5th-century bishop of Arles. Largely due to veneration of the first of these, the name became popular in France in the forms Hilari and Hilaire, and was brought to England by the Norman conquerors.English : from the much rarer female personal name Eulalie (from Latin Eulalia, from Greek eulalos ‘eloquent’, literally well-speaking, chosen by early Christians as a reference to the gift of tongues), likewise introduced into England by the Normans. A St. Eulalia was crucified at Barcelona in the reign of the Emperor Diocletian and became the patron of that city. In England the name underwent dissimilation of the sequence -l-l- to -l-r- and the unfamiliar initial vowel was also mutilated, so that eventually the name was considered as no more than a feminine form of Hilary (of which the initial aspirate was in any case variable).
Girl/Female
Tamil
Anuloma | அநà¯à®²à¯‹à®®à®¾
Sequence
Anuloma | அநà¯à®²à¯‹à®®à®¾
Boy/Male
Indian, Sanskrit
Order; Sequence
Boy/Male
Indian, Sikh
Music; In-sequence
Boy/Male
Afghan, German, Indonesian
Fulfilled Wish; Prayer; Recognition; Acceptance
Girl/Female
Bengali, Gujarati, Hindu, Indian, Kannada, Malayalam, Marathi, Sanskrit, Telugu
Sequence
Boy/Male
Arabic, Muslim
Praise; Hymn of God; Recognition
Boy/Male
Arabic, Australian, Muslim
Mount of Recognition; Pilgrimage Site 25km from Mecca
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
Biblical
an ass; clay; dirt
Girl/Female
Tamil
Iyalisai | இயலீஸாஈ
Music
Boy/Male
Biblical
He gives judgment.
Boy/Male
German
Hebrew John 'Jehovah has been gracious; has shown favor.
Surname or Lastname
Irish
Irish : variant spelling of Connor, now common in Scotland.English : occupational name for an inspector of weights and measures, Middle English connere, cunnere ‘inspector’, an agent derivative of cun(nen) ‘to examine’.
Boy/Male
Bengali, Hindu, Indian, Sindhi, Telugu, Traditional
Trunk of the Elephant
Girl/Female
Arabic, Muslim
Moon of the Women
Girl/Female
Assamese, Hindu, Indian, Malayalam, Marathi, Tamil
Daughter of King Bali
Boy/Male
Indian, Punjabi, Sikh
Brave King of Gods
Boy/Male
Tamil
Ashtavakra | à®…à®·à¯à®Ÿà®¾à®µà®•à¯à®°
One of the great sages
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
RECOGNITION SEQUENCE
n.
Acknowledgment of a person or thing; avowal; profession; recognition.
v. t.
Perception through the intellect; apprehension; recognition; understanding; discernment; appreciation.
n.
A preliminary examination of a criminal case with reference to a prosecution.
n.
Recollection; recognition.
v. t.
The act of knowing; knowledge; perception.
a.
Pertaining to, or connected with, recognition.
n.
One of a jury impaneled on an assize.
v. t.
To mark or note so as to insure recognition; to recognize; to detect; as, to spot a criminal.
n.
Recognition.
v. t.
That which is known.
n.
The science which treats of poisons, their effects, antidotes, and recognition; also, a discourse or treatise on the science.
n.
The recognition by an animal body of the electrical condition of external objects.
n.
Previous cognition.
n.
A just valuation or estimate of merit, worth, weight, etc.; recognition of excellence.
n.
The owning of a benefit received; courteous recognition; expression of thanks.
n.
The act of recognizing, or the state of being recognized; acknowledgment; formal avowal; knowledge confessed or avowed; notice.
n.
Official recognition or permission.
n.
Fig.: Sympathetic recognition; response; answer.
n.
A failure to recognize; absence of recognition.
n.
The quality of being appreciative; quick recognition of excellence.